| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
1 The Cleveland Clinic Foundation Taussig Cancer Center, Cleveland Ohio; 2 University of Toledo, Toledo, Ohio; and 3 MethylGene, Inc., Montreal, Quebec, Canada
Requests for reprints: Ernest C. Borden, The Cleveland Clinic Foundation Taussig Cancer Center, R40, 9500 Euclid Avenue, Cleveland, OH 44195. Phone: 216-444-8183; Fax: 216-636-2498; E-mail: bordene{at}ccf.org.
| Abstract |
|---|
|
|
|---|
2 and IFN-ß (ACHN, SK-RC-45, and A375). 5-AZA-dC and DNMT1 AS similarly depleted available DNMT1 protein and, at doses that did not cause apoptosis alone, resulted in apoptotic response to IFNs. The proapoptotic tumor suppressor RASSF1A was reactivated by DNMT1 inhibitors in all three cell lines. This was associated with demethylation of its promoter region. IFNs augmented RASSF1A protein expression after reactivation by DNMT1 inhibition. In IFN-sensitive WM9 melanoma cells, expression of RASSF1A was constitutive but also augmented by IFNs. RASSF1A small interfering RNA reduced IFN-induced apoptosis in WM9 cells and in DNMT1-depleted ACHN cells. Conversely, lentiviral expression of RASSF1A but not transduction with empty virus enabled IFN-induced apoptosis. IFN induced tumor necrosis factorrelated apoptosis-inducing ligand (TRAIL) and TRAIL-neutralizing antibody inhibited apoptotic response to IFN in RASSF1A-expressing ACHN cells. Accordingly, RASSF1A markedly sensitized to recombinant TRAIL. Normal kidney epithelial cells, although expressing RASSF1A, did not undergo apoptosis in response to IFN or TRAIL but had >400-fold higher TRAIL decoy receptor 1 expression than transduced ACHN cells (real-time reverse transcription-PCR). Results identified RASSF1A as regulated by IFNs and participating in IFN-induced apoptosis at least in part by sensitization to TRAIL. (Cancer Res 2006; 66(5): 2785-93) | Introduction |
|---|
|
|
|---|
Maintenance of DNA methylation in the promoter region of genes can result in heritable silencing of expression just as do mutational deletions (10). The degree of enzymatic redundancy in this process with the maintenance DNA methyltransferase 1 (DNMT1) and de novo DNMTs, such as DNMT 3b (11), is still an unresolved issue. However, at least in a colon (12), a breast, and a lung cancer (13) cell line, inhibition of DNMT1 by oligonucleotide antisense or small interfering RNA (siRNA) was sufficient for reexpression of silenced genes. Epigenetic inactivation of genes that control DNA stability, cell proliferation, and apoptosis is integral to the neoplastic process (10). IFNs have increased expression of tumor suppressor genes, such as p53 (14), that are frequently affected by mutational loss of function in cancer, and other ISGs that can be silenced by DNA methylation, such as XAF1, may have tumor suppressor gene function (5, 6). Nephrectomy specimens and resections of primary melanomas revealed a high frequency of silencing by promoter hypermethylation of the tumor suppressor gene RASSF1A in papillary (up to 100% of patients; ref. 15) and clear cell renal cell carcinoma (RCC; up to 90%; refs. 15, 16) and in melanomas (55%; ref. 17). RASSF1A plays a role in mitosis control; it can furthermore interact with the proapoptotic kinase MST1 and the scaffolding protein CNK1 to induce apoptosis and has facilitated death receptorinduced Bax conformational change and apoptosis by relieving inhibition of MAP-1 (1824). Apoptosis has been increasingly recognized as one of the mechanisms that may play a role in antitumor effects of IFNs (25). We postulated that epigenetic silencing of RASSF1A might confer resistance to apoptosis induction by IFNs in RCC and melanoma. Thus, the effects of the well-established potent DNA demethylating agent 5-AZA-deoxycytidine (5-AZA-dC) were assessed in RCC and melanoma cell lines that were resistant to apoptosis induction by IFNs and did not express RASSF1A. The specific role of DNMT1 for gene silencing and IFN resistance was evaluated using a selective phosphorothioate antisense oligonucleotide inhibitor (DNMT1 AS) in the more readily transfectable RCC cells.
| Materials and Methods |
|---|
|
|
|---|
2b (Schering-Plough, Kenilworth, NJ) and IFN-ß1a (Serono, Rockland, MA) had specific activities of 2 x 108 units/mg protein. Apo2L/tumor necrosis factorrelated apoptosis-inducing ligand (TRAIL) was obtained from PeproTech (Rocky Hill, NJ), rabbit polyclonal TRAIL neutralizing antibody and control rabbit immunoglobulin were from ProSci (Poway, CA). DNMT1 inhibition and siRNA transfections. To down-regulate DNMT1, cells were transfected with MG98 (MethylGene, Montreal, Quebec, Canada), a second-generation 4 x 4 2'O-methyl (bold) phosphorothioate oligonucleotide antisense against the 3' untranslated region of DNMT1 mRNA (5'-TTCATGTCAGCCAAGGCCAC-3') or mismatch control oligonucleotide of similar sequence (5'- TTAATGTAACCTAAGGTCAA -3') starting 1 day after plating at cell concentrations that allowed at least doubling of number in 48 hours and optimal transfection efficiency (5,000 and 15,000 cells/cm2 for SK-RC-45 and ACHN cells, respectively). Transfections were with 6.25 µg/mL Lipofectin in Opti-MEM (Life Technologies/Invitrogen) over 4 hours. Before and after transfections, cells were washed with PBS; every second day, cells were replated 4 hours after the end of the preceding transfection. 5-AZA-dC (Sigma-Aldrich, St Louis, MO) was freshly thawed solution and diluted into media. Cells were replated 4 hours after 5-AZA-dC every 2 days into complete media not containing 5-AZA-dC. siRNA transfections were done like DNMT1 AS transfections but only once and with preincubation of siRNA (0.3 volume of the final amount of Lipofectin) to allow for formation of complexes. siRNAs were obtained from Dharmacon (Lafayette, CO). RASSF1A siRNA sequence was as published (23): 5'-GACCUCUGUGGCGACUUCA-3' (sense); control siRNA sequence was 5'-CACGUCUCUCCCGACUAGA-3' (sense).
Western blotting. Protein (20-40 µg) from whole-cell lysates were probed for DNMT1 by polyclonal antibodies (MethylGene); signal transducers and activators of transcription 1 (STAT1), STAT2, STAT3 by monoclonal antibody (mAb; BD Transduction Laboratories, San Jose, CA); caspase-3 by pAB (Biomol International L.P., Plymouth Meeting, PA); RASSF1A by mAb (eBioscience, San Diego, CA); MST1 by pAB (Cell Signaling, Beverly, MA); and actin by mAb (Sigma-Aldrich) after separation in 8% to 14% SDS-polyacrylamide gels and transfer to polyvinylidene difluoride (PVDF) membranes. For detection of bound primary antibody, PVDF membranes were incubated with horseradish-tagged goat anti-mouse or goat anti-rabbit antibody (Bio-Rad, Hercules, CA) followed after washing with TBST, by staining with enhanced chemiluminescence solution (Amersham, Piscataway, NJ). To compare relative RASSF1A expression, densitometry was done using Bio-Rad Chemi Doc XRS and Quantity One-4.5.2 1D analysis software (Bio-Rad). All signals were normalized to corresponding actin signals of stripped membranes.
Apoptosis assays. For terminal deoxynucleotidyl transferasemediated nick-end labeling (TUNEL) assay, cells were harvested and processed according to the manufacturer's instructions (BD PharMingen, San Diego, CA). Apoptosis was confirmed with an assay for the activity of caspase-3 (BD Clontech, Palo Alto, CA), done according to the manufacturer's instructions, or caspase-3 cleavage detection by immunoblot (polyclonal caspase-3 antibody from Biomol International) 48 hours after IFNs. All results were confirmed with at least one additional analysis.
RNA isolation and cDNA synthesis for PCR. RNA was isolated using Trizol (Invitrogen, Carlsbad, CA) and cDNA prepared with a superscript III first-strand synthesis kit, including a final Rnase H digestion step (Invitrogen), according to the manufacturer. For real-time reverse transcription-PCR (RT-PCR), custom Taqman expression primers (Applied Biosystems, Foster City, CA) were used according to the manufacturer instructions using ABI PRISM Sequence Detection Instrument 7700 (Applied Biosystems).
Bisulfite modification and methylation-specific PCR. Genomic DNA (1 µg), harvested with a blood DNA mini kit (Qiagen, Valencia, CA), for bisulfite modification with the CpGenome kit (Chemicon International, Temecula, CA) according to the manufacturer's instructions; 4 µL of bisulfite modified DNA was used per 25 µL methylation-specific PCR (MSP) reaction. Primers for RASSF1A MSP were as published (26). For PCR, methylated (M) primer pairs were denatured at 95°C for 5 minutes followed by 35 cycles with a 1-minute denaturation step, 30 seconds of annealing at 60°C, and 30 seconds of extension at 72°C. Final extension after 35 cycles was at 72°C for 4 minutes. For sequences specific for unmethylated (U) DNA, annealing was at 55°C.
RASSF1A reactivation and sequencing. RT-PCR was with primers that amplified RASSF1 variants regulated by a promoter hypermethylated in cancer (19). Primers were 5'-AGCGTGCCAACGCGCTGCGCAT-3' (sense) and 5'-CAGGCTCGTCCACGTTCGTGTC-3' (antisense). Settings were 95°C for 4 minutes (95°C for 1 minute, 52°C for 30 seconds, 72°C for 30 seconds for 30 to 35 cycles) and 72°C for 4 minutes. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified with the settings 95°C for 4 minutes (95°C for 45 seconds, 55°C for 30 seconds, 72°C for 50 seconds for 15 to 25 cycles) and 72°C for 4 minutes. GAPDH primers were 5'-CAGACCTACTCAGGGATTC-3' (sense) and 5'-GAGCCAGACGCTGCTTTGT-3' (antisense). For sequencing of full-length RASSF1 cDNA in DNMT1 AStreated ACHN cells, RT-PCR with primers 5'-CGCCCAGTCTGGATCCTG-3' (sense) and 5'-CTCAATGCCTGCCTTATTCTG-3' (antisense) was done using proofreading platinum Pfx polymerase (Invitrogen): denaturation at 95°C for 4 minutes followed by 30 cycles at 95°C for 45 seconds, annealing at 58°C for 30 seconds, and extension at 68°C for 3 minutes followed by final extension at 68°C for 8 minutes. Products were cloned into Zero Blunt cloning vector and then into pcDNA4 for expansion. Sequencing of four independent bacterial clones all identified RASSF1A (NM_007182) with a single nucleotide polymorphism at nucleotide 528 (T instead of G), leading to a conservative change at amino acid position 133 (serine for alanine). Before cloning into lentivirus, all CpG sites 5' of the translation start site were excluded by amplification with primers 5'-GGATCCACCATGTCGGGG-3' (sense) and 5'-CTTCCGTCTGTCGTCCGCTATAG-3' (antisense) using proofreading platinum Pfx polymerase (Invitrogen): denaturation at 94°C for 4 minutes followed by 25 cycles of denaturation at 94°C for 30 seconds, annealing at 63°C for 30 seconds, and extension at 68°C for 2 minutes followed by final extension at 68°C for 8 minutes.
Construction of RASSF1A lentivirus and transduction. RASSF1A cDNA from DNMT1 AStreated cells was used for overexpression. The BamHI and EcoRV fragment of the RASSF1A open reading frame was subcloned into the corresponding sites of a modified self-inactivating lentiviral vector LRV (6.9 kb), with a blasticidin resistance marker (confirmed by sequencing) and was then transfected into 293T cells along with the packaging plasmids possessing the gag-pol, rrev, and vesicular stomatitis virus glycoprotein G for production and propagation of transducable Lenti-RASSF1A virus. Transductions into ACHN cells were two to three times at 20 to 30 multiplicities of infection of Lenti-RASSF1A virus (10 µg/mL polybrene); 3 days later, blasticidin (10 µg/mL) was added. Colonies were pooled, expanded, and RASSF1A verified by Western blot using RASSF1A mAb (eBioscience). Subsequently, the RASSF1A-expressing cells were selected in medium containing blasticidin, and sequence confirmation was repeated.
| Results |
|---|
|
|
|---|
2 or IFN-ß alone, were resistant to induction of apoptosis at doses up to 500 units/mL (<5% apoptotic cells on TUNEL; Fig. 1A-C). To determine whether a potent DNMT1 inhibitor would influence apoptosis induction by IFNs, cells were treated with 5-AZA-dC for 2 to 6 days. After incorporation into DNA, 5-AZA-dC covalently binds DNMT1, leading to reduction of available DNMT1 protein in cells and whole-cell lysates (10, 12). Although 5-AZA-dC alone resulted in some apoptosis, apoptosis was markedly increased after the addition of IFN-
2 and even more so after IFN-ß (Fig. 1A-C).
|
4 days for NHEM, 3 days for NKE 01, and 2 days for NKE 02 (data not shown). To confirm reduction in DNMT1, cell lysates were subjected to Western blot analysis. 5-AZA-dC markedly decreased DNMT1 protein (immunoblots in Fig. 1A-D). To determine whether DNMT1 depletion was sufficient for overcoming resistance to IFN-induced apoptosis, ACHN cells were transfected daily with 40 nmol/L DNMT1 AS. Nearly complete suppression of DNMT1 protein was achieved by day 4 in ACHN cells (Fig. 2A). In contrast, DNMT1 AS did not influence expression of STAT1, STAT2, or STAT3 (Fig. 2A). This latter result was further confirmed by RT-PCR for STAT1 (data not shown) and cRNA array (data not shown).
|
2 or IFN-ß (Fig. 2A). Mismatch control oligonucleotide did not sensitize to IFN-induced programmed cell death (Fig. 2A). Apoptosis was confirmed by immunoblotting for detection of cleaved (activated) caspase-3 (Fig. 2A) and by caspase-3 activity assays (data not shown).
Similarly in SK-RC-45 cells, after 4 or 6 days of DNMT1 AS treatment, complete suppression of DNMT protein expression was achieved with no effect of the mismatch (Fig. 2B). Treatment with 500 units/mL IFN-
2 or IFN-ß after DNMT1 depletion for 6 days increased the apoptotic fraction from 5.4 ± 4.5% to 23.4 ± 12% and 45 ± 1% (mean ± SD), respectively, whereas after mismatch IFNs caused apoptosis in <10% of cells (Fig. 2B). Apoptosis was also confirmed by caspase-3 activity assays (data not shown).
In A375 melanoma cells, only minimal reduction of DNMT1 protein resulted from nontoxic concentrations of DNMT1 AS (data not shown), whereas treatment with 200 nmol/L 5-AZA-dC over 4 days reduced available DNMT1 protein and increased frequency of apoptotic cells from 1.5 ± 1.1% in controls to 22.9 ± 3% (mean ± SD) after 100 units/mL IFN-ß, while alone causing little apoptosis (4.7 ± 1.85% apoptotic cells; Fig. 1C).
Because the lowest nontoxic schedule of 5-AZA-dC resulted in less IFN-induced apoptosis than the DNMT1 AS in the RCC cell lines, DNMT1 AS was mostly used for subsequent experiments with these cells, and subsequent experiments in A375 used 5-AZA-dC.
Effects of DNMT1 depletion on expression and promoter region of RASSF1A. To determine whether RASSF1A might be involved in induction of apoptosis by IFNs after DNMT1 inhibition, its expression was assessed in the IFN-resistant cell lines after both DNMT1 AS and 5-AZA-dC. Duration of DNMT1 depletion correlated with reexpression of RASSF1A mRNA, as shown in ACHN cells (Fig. 3A). DNMT1 AS (40 nmol/L over 6 days) or 5-AZA-dC (200 nmol/L over 4 days) also reactivated RASSF1A expression in SK-RC-45 cells (Fig. 3A). Although it was not possible to deplete DNMT1 by AS at doses allowing for continuing cell divisions in A375 cells 5-AZA-dC led to reactivation of RASSF1A expression (Fig. 3A). To confirm that RASSF1A expression was related to methylation status of its promoter region, MSP was undertaken. Reactivation of RASSF1A was associated with demethylation of a promoter CpG island in ACHN cells (Fig. 3B).
|
Hypothesizing that RASSF1A might be involved in IFN-induced apoptosis, its expression was determined in a melanoma cell line (WM9) known to undergo programmed cell death upon treatment with IFN-ß (27). In contrast to ACHN cells, RASSF1A mRNA and protein were constitutively expressed in WM9 cells (Fig. 3A and C). Addition of IFN-ß to WM-9 cells further augmented RASSF1A protein expression (Fig. 3C). Thus, unless RASSF1A was silenced, IFNs could increase RASSF1A expression.
To further assess interactions between IFNs and RASSF1A, activation of MST1, an apoptotic partner molecule of RASSF1A, was also assessed. MST1 was cleaved (activated; ref. 28) after IFNs in DNMT1 AS but not control oligonucleotide (mismatch)pretreated ACHN cells (Fig. 3C). Thus, not only did IFNs augment RASSF1A expression, but the increased protein was associated with enhanced proapoptotic protein activation.
Effect of suppression of RASSF1A by siRNA on IFN-induced apoptosis. To determine whether RASSF1A played a role in apoptosis induction by IFNs, ACHN cells depleted of DNMT1 by AS were transfected with RASSF1A siRNA followed by IFN treatment. Inhibition of RASSF1A by siRNA decreased IFN-induced apoptosis in DNMT1 ASpretreated cells from 63.9 ± 9.19% in control siRNA treated cells to 35 ± 4.1% (mean ± SD), as determined by frequency of TUNEL-positive cells (Fig. 4A). Parallel assessment of RASSF1A protein expression by densitometry of Western blots identified 67% reduction in DNMT1 AStreated cells and 61% reduction in DNMT1 AS and IFN-ßtreated cells by specific compared with control siRNA (Fig. 4A). Absence of IFN induction by the control siRNA was assessed by real-time RT-PCR for the ISGs XAF1, IRF1, and USP18. None of these genes were up-regulated compared with treatment with Lipofectin transfection reagent alone (0.6-, 1.1-, and 1.0-fold induction, respectively, for each gene).
|
Effect of lentiviral expression of RASSF1A on apoptosis induction by IFNs. To further confirm the role of RASSF1A in overcoming resistance to IFN-induced apoptosis, independent of any other genes reactivated by DNMT1 depletion, forced expression of RASSF1A using a lentiviral construct (Fig. 5A) was undertaken. After transduction, the population of transduced cells was kept in selective antibiotic for 14 days before RASSF1A protein expression and sensitivity to IFN-induced apoptosis were assessed. Of RASSF1A-transduced cells, 16.83 ± 0.98% underwent apoptosis in response to 50 units/mL IFN-ß compared with 3.77 ± 1.67% (mean ± SD) of empty virustransfected cells (Fig. 5B). Subcloning of stably transduced cells showed that clones that expressed RASSF1A at levels comparable with the ones achieved by DNMT1 AS treatment (78%, 234%, and 134% relative RASSF1A expression compared with DNMT1 AS by densitometry in clones 1.3, 1.7, and 1.8, respectively; Fig. 5B) underwent apoptosis in response to 50 units/mL IFN-ß (20-40% apoptotic cells; Fig. 5B). Thus, RASSF1A alone could overcome resistance to IFN-induced apoptosis.
|
NKE cells expressed RASSF1A (Fig. 3B) but even after 5-AZA-dC treatment remained resistant to IFN and Apo2L/TRAIL-induced apoptosis (Fig. 1D and Fig. 5D). Real-time RT-PCR identified >400-fold higher TRAIL decoy receptor 1 (TRAIL DcR1) expression in NKE compared with transduced ACHN cells, whereas TRAIL receptor 1 and 2 (TRAIL R1 and R2) expression was similar. 5-AZA-dC did not markedly alter the relative expression of proapoptotic (TRAIL R1and R2) to cell-protective (TRAIL DcR1 and DcR2) TRAIL receptors but modestly increased them all (Table 1). This suggested that RASSF1A sensitized to IFN-induced apoptosis at least in part by sensitization to Apo2L/TRAIL, and that strong expression of TRAIL DcR1 might protect certain RASSF1A expressing nonmalignant cells from apoptosis induction by IFN or Apo2L/TRAIL.
|
| Discussion |
|---|
|
|
|---|
2 and IFN-ß (500 units/mL) with the DNA-demethylating nucleoside analogue 5-AZA-dC overcame resistance to IFN-induced apoptosis (Fig. 1A-C) and reactivated expression of RASSF1A (Fig. 3).
5-AZA-dC is a nucleoside analogue that after incorporation into DNA inhibits DNMT1 by covalent binding (10). DNMT1 is thus trapped and not available at the DNA replication fork to copy methylation patterns from mother to daughter strand, resulting in demethylation upon cell division. The covalent binding of the
190-kDa DNMT1 protein to DNA, however, also results in DNA damage; thus, 5-AZA-dC may have effects in cells, independent of its DNA-demethylating activity (29, 30). Sensitization to IFN-induced apoptosis was observed at 5-AZA-dC doses that did not result in apoptosis alone (Fig. 1) associated with reactivation of RASSF1A mRNA expression (Fig. 3A). More importantly, specific inhibition of DNMT1 AS similarly reactivated RASSF1A and overcame resistance to apoptosis induction by IFNs (Figs. 2-3). Compared with mismatch control oligonucleotide, transfection reagent alone, and media alone, DNMT1 AS did not induce ISGs (Fig. 2A; data not shown), suggesting that its effect on IFN resistance was due to DNMT1 depletion (Fig. 2A) and associated DNA demethylation (Fig. 3B). These results furthermore support that at least in RCC cells, which were more amenable to down-regulation of DNMT1 by AS than studied melanoma cells, DNMT1 was critical for silencing of genes.
Containing a diacylglycerol and a rasGTP binding domain but no catalytic activity, RASSF1A has influenced function of binding partners, including the E1A-regulated transcription factor p120 (E4F; ref. 31), the proapoptotic kinase MST1 (20, 22, 32), the scaffold protein CNK1 (22), and cdc20, an activator of anaphase promoting complex (24). Interaction of RASSF1A with cdc20 regulated mitotic progression (21, 24) and apoptosis resulted when RASSF1A was coexpressed with the scaffold protein CNK1 (22). RASSF1A directed MST1 to the cell membrane, where MST1 can be activated influencing apoptosis (20, 22). Because it was activated by IFNs after RASSF1A reexpression (Fig. 3C), MST1 may be contributory to the apoptotic effects of IFNs. Interestingly, IFNs also increased protein expression of RASSF1A after DNMT1 depletion and in cells with baseline expression (Fig. 3C). The exact mechanism of RASSF1A protein regulation by IFNs will need to be studied in future experiments, but real-time RT-PCR results suggest post-transcriptional events (data not shown).
In DNMT1-depleted ACHN cells, selective suppression of RASSF1A by siRNA reduced apoptosis in response to IFN from 63.9 ± 9.19% to 35 ± 4.1% (mean ± SD; Fig. 4A). Rationalizing that cells sensitive to apoptosis induction by IFNs might express RASSF1A, WM9 cells (27) were studied. Without treatment, RASSF1A was expressed, IFN increased expression (Fig. 3A and C), and RASSF1A siRNA reduced IFN-ßinduced apoptosis from 60.45 ± 3.18% to 39.2 ± 3.11%, accompanied by reduction of RASSF1A protein expression (Fig. 4B). Conversely, in ACHN cells, lentiviral expression of RASSF1A protein to levels comparable with the one achieved by DNA demethylation overcame resistance to IFN-induced apoptosis (Fig. 5).
Recent evidence has suggested requirement of RASSF1A for death receptorinduced Bax conformational change and apoptosis. RASSF1A enabled Bax apoptotic signaling by relieving an inactivating intramolecular conformation of a necessary partner molecule of Bax, BH3-like protein modulator of apoptosis-1 (MAP-1; ref. 18). Apo2L/TRAIL was induced by IFN-ß (50 units/mL) in ACHN cells, 20- to 25-fold as determined by real-time RT-PCR (data not shown), and TRAIL-neutralizing antibody inhibited IFN-induced apoptosis of RASSF1A-expressing cells (Fig. 5C). Accordingly, RASSF1A markedly sensitized ACHN cells to Apo2L/TRAILinduced cell death (Fig. 5D).
On the other hand, NKE cells did not undergo programmed cell death in response to IFN or TRAIL despite expression of RASSF1A and no synergism of 5-AZA-dC with either drug was observed (Fig. 1D, Fig. 3A, and Fig. 4D). Real-time RT-PCR before and after 4 days of 5-AZA-dC treatment revealed >400-fold higher TRAIL DcR1 expression in NKE compared with ACHN cells (Table 1). TRAIL decoy receptors bind Apo2L/TRAIL without transmission of apoptotic signals into the cell (33). Thus, RASSF1A overcame resistance to IFN-induced apoptosis at least in part by sensitization to Apo2L/TRAIL, and strong TRAIL decoy receptor expression might protect certain nonmalignant RASSF1A-expressing cells from cell death induction by IFN or Apo2L/TRAIL.
Promoter hypermethylation of ISGs, including DAPK (mainly lymphoid malignancies), XAF1 (gastric), and IRF7 (fibrosarcoma), as well as of genes essential for IFN apoptotic signaling, like TRAIL R1 and caspase-8 (lung), have been identified in cell lines and/or biopsy specimens (69). Although not described as frequently hypermethylated in renal cancer, reactivation of such genes could have contributed to sensitization of ACHN cells to IFN-induced apoptosis after DNMT1 depletion. However, except for one ISG of unknown function, IFI27, no other ISGs or genes known to be essential for IFN apoptotic signaling (25) were increased in expression by DNMT1 AS treatment in ACHN cells, as determined by U133A Affymetrix cRNA array (data not shown). Although TRAIL R1 and TRAIL R2 were not represented on the array, quantitative RT-PCR did not identify evidence for their reactivation by DNMT1 AS (data not shown). However, among the 137 genes increased at least 2-fold in DNMT1 AS over mismatch treated cells, eight had roles in apoptosis and also may have contributed to overcoming resistance to IFN-induced programmed cell death by influencing apoptotic pathways (small GTPase ARHGDIB), inhibition of NF-
B (NFKBIA, IER3, and C8FW), or other mechanisms (PHLDA1, NAC, STK17A, and ASC; data not shown).
IFN-
2 has increased survival of patients with metastatic RCC in randomized trials, albeit only for several weeks to months (1, 34). Prolongation of disease-free and possibly overall survival has resulted when IFN-
2 has been administered to melanoma patients for high-risk primary disease (1). Resistance of RCC and melanoma cells to the apoptosis-inducing effects of IFN-
2 and IFN-ß was overcome by inhibition of DNMT1 (Figs. 1 and 2). This was at least in part due to reactivation of the tumor suppressor gene RASSF1A (Figs. 4 and 5) that is frequently silenced by DNA methylation in RCC and melanoma (1517) and as shown herein up-regulated in expression by IFNs (Fig. 3C). By targeting DNMT1 in RCC and melanoma, clinical antitumor effects of IFNs may be augmented through reactivation of silenced RASSF1A and possibly by reactivation of other heterogeneously silenced genes in IFN pathways.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Barbara Jacobs and Mamta Chawla-Sarkar for their invaluable assistance and advice for initiation of these studies.
Received 6/30/05. Revised 11/ 9/05. Accepted 12/30/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Peters, B. Vaske, K. Albrecht, M. A. Kuczyk, U. Jonas, and J. Serth Adiposity and Age are Statistically Related to Enhanced RASSF1A Tumor Suppressor Gene Promoter Methylation in Normal Autopsy Kidney Tissue Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2526 - 2532. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Gollob and C. J. Sciambi Decitabine Up-regulates S100A2 Expression and Synergizes with IFN-{gamma} to Kill Uveal Melanoma Cells Clin. Cancer Res., September 1, 2007; 13(17): 5219 - 5225. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Gumz, H. Zou, P. A. Kreinest, A. C. Childs, L. S. Belmonte, S. N. LeGrand, K. J. Wu, B. A. Luxon, M. Sinha, A. S. Parker, et al. Secreted Frizzled-Related Protein 1 Loss Contributes to Tumor Phenotype of Clear Cell Renal Cell Carcinoma Clin. Cancer Res., August 15, 2007; 13(16): 4740 - 4749. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Reu, S. I. Bae, L. Cherkassky, D. W. Leaman, D. Lindner, N. Beaulieu, A. R. MacLeod, and E. C. Borden Overcoming Resistance to Interferon-Induced Apoptosis of Renal Carcinoma and Melanoma Cells by DNA Demethylation J. Clin. Oncol., August 10, 2006; 24(23): 3771 - 3779. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |